View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5759_high_27 (Length: 293)
Name: NF5759_high_27
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5759_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 14 - 147
Target Start/End: Complemental strand, 19190484 - 19190351
Alignment:
| Q |
14 |
atatccacccccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccagaacggtcatcggaaccataaccaccaccaaaacgt |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190484 |
atatccaccaccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccagaacggtcatcggaaccataaccaccaccaaaacgt |
19190385 |
T |
|
| Q |
114 |
ccacctccatacccgctctcgttattattcccat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19190384 |
ccacctccatacccgctctcgttattattcccat |
19190351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 19190286 - 19190223
Alignment:
| Q |
212 |
tccataaccactgttagatcggttatcaagaccgtaaccaccacctgtagtaccaccaccataa |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190286 |
tccataaccactgttagatcggttatcaagaccgtaaccaccacctgtagtaccaccaccataa |
19190223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University