View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5759_high_31 (Length: 259)
Name: NF5759_high_31
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5759_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 15 - 244
Target Start/End: Complemental strand, 37055611 - 37055382
Alignment:
| Q |
15 |
agaaggcctggtacaactacaactgccaaaggttcaggggttccctgctttgcttggagtagcattaaagacagtactgtttcagatcttattttcattc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37055611 |
agaaggcctggtacaactacaactgccaaaggttcaggggttccctgctttgcttggagtagcattaaagacagtactgtttcagatcttattttcattc |
37055512 |
T |
 |
| Q |
115 |
accagcactaaccaaatgaaaaaatattcannnnnnnngatgnnnnnnnnnnnnnggaaacaagcttttataagaggaaagctgcattaacttttagttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37055511 |
accagcactaaccaaatgaaaaaatattcatttttttttatgaaaaaaacaaaaaggaaacaagcttttataagaggaaagctgcattaacttttagttg |
37055412 |
T |
 |
| Q |
215 |
gaagaaagaaaaagaaaatgagttgtggtt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37055411 |
gaagaaagaaaaagaaaatgagttgtggtt |
37055382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University