View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5759_low_29 (Length: 278)
Name: NF5759_low_29
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5759_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 37055627 - 37055382
Alignment:
| Q |
18 |
aggagcagagaagtaaagaaggcctggtacaactacaactgccaaaggttcaggggttccctgctttgcttggagtagcattaaagacagtactgtttca |
117 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37055627 |
aggaacagggaagtaaagaaggcctggtacaactacaactgccaaaggttcaggggttccctgctttgcttggagtagcattaaagacagtactgtttca |
37055528 |
T |
 |
| Q |
118 |
gatcttattttcattcaccagcactaaccaaatgaaaaaatattcannnnnnnngatgnnnnnnnnnnnnnggaaacaagcttttataagaggaaagctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
37055527 |
gatcttattttcattcaccagcactaaccaaatgaaaaaatattcatttttttttatgaaaaaaacaaaaaggaaacaagcttttataagaggaaagctg |
37055428 |
T |
 |
| Q |
218 |
cattaacttttagttggaagaaagaaaaagaaaatgagttgtggtt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37055427 |
cattaacttttagttggaagaaagaaaaagaaaatgagttgtggtt |
37055382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University