View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5759_low_32 (Length: 270)
Name: NF5759_low_32
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5759_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 28 - 262
Target Start/End: Complemental strand, 48842954 - 48842714
Alignment:
| Q |
28 |
agtatattgttaaaattatatgcttgtgacaggtaccttgttagtatccatgatttatgaaacaatcatattgggatctaccaactaagaacataaacaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48842954 |
agtatattgttaaaattatatgcttgtgacaggtaccttgttagtatccatgatctatgaaacaatcatattgggatctaccaactcagaacataaacaa |
48842855 |
T |
 |
| Q |
128 |
ttacagatgaatcttttaaacatgatgca------tatataaacaggatattttttcacaattcacaagccaatatccatgcaataccaaccggtccagc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48842854 |
ttacagatgaatcttttaaacatgatgcatactcctatataaacaggatattttttcacaattcacaagccaatatccatgcaataccaaccggtccaac |
48842755 |
T |
 |
| Q |
222 |
aataccaactcaaaacacacttgtaacagccacacgtctct |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48842754 |
aataccaactcaaaacacacttgtaacagccacacgtctct |
48842714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University