View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5759_low_34 (Length: 257)
Name: NF5759_low_34
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5759_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 49 - 218
Target Start/End: Original strand, 48842452 - 48842622
Alignment:
| Q |
49 |
tctcgcattctacgaatgatgaacaatc-atccaaaaacacaccaaagtttgttgtttagcactcatggtatacatcttgaactgaccattttatctccg |
147 |
Q |
| |
|
||||||||| | ||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48842452 |
tctcgcattttccgagggatgaacaatccatccaaaaacacaccaaagtttgttgtttagcaatcatggtatacatcttgaactgtccattttatctcca |
48842551 |
T |
 |
| Q |
148 |
gtagcagttaacgatcgttcgttggggaatggcaattaactatcttttcagacctacgtatacatgatcac |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48842552 |
gtagcggttaacgatcgttcgttggggaacggcaattaactatcttttcagacctacgtatacatgatcac |
48842622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University