View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5759_low_37 (Length: 235)

Name: NF5759_low_37
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5759_low_37
NF5759_low_37
[»] chr2 (2 HSPs)
chr2 (166-213)||(21521416-21521463)
chr2 (18-61)||(21516416-21516459)


Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 21521416 - 21521463
Alignment:
166 aagtaaactgaatcagtatcaaaattcagtgaaattcacaccaattcg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
21521416 aagtaaactgaatcagtatcaaaattcagtgaaattcacaccaattcg 21521463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 21516416 - 21516459
Alignment:
18 aatattgcatgaaaataaataactgaatgataaattgcagaatt 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
21516416 aatattgcatgaaaataaataactgaatgataaattgcagaatt 21516459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University