View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5759_low_37 (Length: 235)
Name: NF5759_low_37
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5759_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 21521416 - 21521463
Alignment:
| Q |
166 |
aagtaaactgaatcagtatcaaaattcagtgaaattcacaccaattcg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21521416 |
aagtaaactgaatcagtatcaaaattcagtgaaattcacaccaattcg |
21521463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 21516416 - 21516459
Alignment:
| Q |
18 |
aatattgcatgaaaataaataactgaatgataaattgcagaatt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21516416 |
aatattgcatgaaaataaataactgaatgataaattgcagaatt |
21516459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University