View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5759_low_39 (Length: 217)
Name: NF5759_low_39
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5759_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 21 - 195
Target Start/End: Original strand, 52628719 - 52628893
Alignment:
| Q |
21 |
gaagtccaaaacaaagatgaactattatattgtgaatgactaatgacatattcaacaccttaaaacttaaaaatataactaaccggataaaacttatcaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52628719 |
gaagtccaaaacaaagatgaactattatattgtgaatgacgaatgacatattcaacaccttaaaacttaaaaatataactaaccggataaaacttatcaa |
52628818 |
T |
|
| Q |
121 |
taannnnnnnnnnnnnnnnnnnnaacaaatatctatataatatttgttaacataatcctagatttaaatagcacg |
195 |
Q |
| |
|
||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52628819 |
taatttttatttttaaaatttttaacaaatatctatatagtatttgttaacataatcctagatttaaatagcacg |
52628893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University