View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5760-Insertion-7 (Length: 249)
Name: NF5760-Insertion-7
Description: NF5760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5760-Insertion-7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 8 - 164
Target Start/End: Complemental strand, 2813779 - 2813623
Alignment:
| Q |
8 |
ttattaattatatcactactgtaaataaattatatacatagcacaaatgaccactataatatatgatttgaaatttaaaataatcattggtatattatgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
2813779 |
ttattaattatatcactactgtaaataaattatatacatagcacaaatgaccactataatatatgatttgaaatttaaaataatcatggatatattatgt |
2813680 |
T |
 |
| Q |
108 |
tcctgttattacaaactgcaaaataataaaacgttttgcagatgtaagactactatg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813679 |
tcctgttattacaaactgcaaaataataaaacgttttgcagatgtaagactactatg |
2813623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 203 - 249
Target Start/End: Complemental strand, 2813549 - 2813503
Alignment:
| Q |
203 |
tcggatgaataagtatctgtctccattggcattgctgcatatcttcc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813549 |
tcggatgaataagtatctgtctccattggcattgctgcatatcttcc |
2813503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University