View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5760_high_21 (Length: 210)

Name: NF5760_high_21
Description: NF5760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5760_high_21
NF5760_high_21
[»] chr8 (1 HSPs)
chr8 (153-192)||(3116386-3116425)


Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 192
Target Start/End: Complemental strand, 3116425 - 3116386
Alignment:
153 cacttgttttgatggaaaatctcaaagcaggggtaaaaga 192  Q
    |||||||||||||||||||||||||||||| |||||||||    
3116425 cacttgttttgatggaaaatctcaaagcagaggtaaaaga 3116386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University