View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5760_high_24 (Length: 202)
Name: NF5760_high_24
Description: NF5760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5760_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 186
Target Start/End: Original strand, 47900375 - 47900538
Alignment:
| Q |
23 |
ttttgaaacggatggagtatgcttctctacgcttaaagtgtgtagattccatttgcaaactctttggaaaattatgtgatcatgtggaaaaaccacaagt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47900375 |
ttttgaaacggatggagtatgcttctctacgcttaaagtgtgttgattccatttgcaaactctttggaaaattatgtgatcatgtggaaaaaccacaagt |
47900474 |
T |
 |
| Q |
123 |
cctacctaaaatagataactaataacatttatttgcaagtcgatattgcgaggattcgttagat |
186 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||| |||| || ||||||||||||||| |
|
|
| T |
47900475 |
cctacctaaaatagataaataataacattcatttgcaagttgatagtgtgaggattcgttagat |
47900538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University