View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5760_low_16 (Length: 261)
Name: NF5760_low_16
Description: NF5760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5760_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 51339828 - 51339592
Alignment:
| Q |
7 |
gtgagaagaaatatctaaccatcatgtgtgggatgggagaatggtccccgtgtgtcatagggtactagatcaaagaatacaacgggaactttattttgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51339828 |
gtgagaagaaatatctaaccatcatgtgtgggatgggagaatggtccccgtgtgtcatagggtactagatcaaagaatacaacgggaactttattttgaa |
51339729 |
T |
|
| Q |
107 |
attaagaggaaaatttctaaagttggcttatggacaaacgtacatgtcaacactgagaaggaaaatcacgaggaactgagaaagaaattctatttcaaaa |
206 |
Q |
| |
|
|| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51339728 |
atcaagaggaaaatttctattgttggctaatggacaaacgtacatgtcaacactgagaaggaaaatcacgaggaactgagaaagaaattctatttcaaaa |
51339629 |
T |
|
| Q |
207 |
tagtgtaagatagatgacctagctatagcctagagac |
243 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51339628 |
tagtgtaagatagatgacatagctatagcctagagac |
51339592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University