View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5760_low_20 (Length: 214)
Name: NF5760_low_20
Description: NF5760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5760_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 105 - 191
Target Start/End: Complemental strand, 50468102 - 50468016
Alignment:
| Q |
105 |
ttacaattaagcctaatttgtttaattggacttgaattaaacaatctatttatcagaaatagatcaaacaaatttttaaggatgaca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50468102 |
ttacaattaagcctaatttgtttaattggacttgaattaaacaatctatttatcagaaatagatcaaacaaatttttaaggatgaca |
50468016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 51
Target Start/End: Complemental strand, 50468139 - 50468102
Alignment:
| Q |
14 |
aattctctgtaataattgaatgactaaaagtttaattt |
51 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50468139 |
aattctctgtaataattgaatgactaatagtttaattt |
50468102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University