View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761-Insertion-8 (Length: 106)
Name: NF5761-Insertion-8
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761-Insertion-8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 6e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 6e-22
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 1288260 - 1288200
Alignment:
| Q |
8 |
tataatctacctgatatgggacatagtaatttttcaattcacacaaacacacttggtgttc |
68 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1288260 |
tataatctaccggatatgggacataataatttttcaattcacacaaacacacttggtgttc |
1288200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University