View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_high_24 (Length: 346)
Name: NF5761_high_24
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 46503193 - 46503521
Alignment:
| Q |
1 |
ccccacaagaactacaaagcaataagccaaacactctcttttgctcttgtttcttcctacatacaaaccaccttcttttctattttgtcatatgaacata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503193 |
ccccacaagaactacaaagcaataagccaaacactctcttttgctcttgtttcttcctacatacaaaccaccttcttttctattttgtcatatgaacata |
46503292 |
T |
 |
| Q |
101 |
tctatatcttaaaaaacagtgattattatttagttttttaacaaagaatggcttcatcatctgaactaggcttggattgcaagccacatagctactccat |
200 |
Q |
| |
|
||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503293 |
tctatatcttaaaaaacagtgcttataatttatttttttaacaaagaatggcttcatcatctgaactaggcttggattgcaagccacatagctactccat |
46503392 |
T |
 |
| Q |
201 |
gttactgaaatcatttggagaacaaagtgatcaaagctacaaactcgaagaatttgtttctcgcttagaagaagaacgtctcaaaatcgatgctttcaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503393 |
gttactgaaatcatttggagaacaaagtgatcaaagctacaaactcgaagaatttgtttctcgcttagaagaagaacgtctcaaaatcgatgctttcaaa |
46503492 |
T |
 |
| Q |
301 |
cgtgagcttcctctctgcatgcaacttct |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46503493 |
cgtgagcttcctctctgcatgcaacttct |
46503521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University