View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_high_36 (Length: 262)
Name: NF5761_high_36
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_high_36 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 4 - 262
Target Start/End: Complemental strand, 44991086 - 44990828
Alignment:
| Q |
4 |
ggagcagcacagaagcagacatgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggaagtacacgaac |
103 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44991086 |
ggagcaacactgaagcagacatgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggtagtacacgaac |
44990987 |
T |
 |
| Q |
104 |
caagtctccggtgacacatccaaccacttcaatttctggtcaacccaacagttcaatttcttcttgctcttctttagcaccaaactcttttgctgaagaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990986 |
caagtctccggtgacacatccaaccacttcaatttctggtcaacccaacagctcaatttcttcttgctcttctttagcaccaaactcttttgctgaagaa |
44990887 |
T |
 |
| Q |
204 |
gaagaagacatcgacatggaaattgaaactgatgatgatggtgaagatagttgtgatat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990886 |
gaagaagacatcgacatggaaattgaaactgatgatgatggtgaagatagttgtgatat |
44990828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University