View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_high_46 (Length: 227)
Name: NF5761_high_46
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_high_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 2734668 - 2734823
Alignment:
| Q |
1 |
ttaagtttgttgcaagcataaagtagcgatacaaataatttctcagtggatgtatatctagtctaagcatcattcaagattcggctaagtccattccatc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2734668 |
ttaagtttgttgcaagcatagagtagcgatacaaataatttctcagtggatgtatatctagtctaagcatcattcaagattcgactaagtccattccatc |
2734767 |
T |
|
| Q |
101 |
atcgatatcttgtgctagcaagaacccgattgactcatcttttgcgacaatgtaca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2734768 |
atcgatatcttgtgctagcaagaacccgattgactcatcttttgcgacaatgtaca |
2734823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University