View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_high_54 (Length: 204)
Name: NF5761_high_54
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 9 - 111
Target Start/End: Complemental strand, 32751816 - 32751714
Alignment:
| Q |
9 |
agcagaacctgtgactgcttataaatcatttgatgatcannnnnnnnnnnnnnnnnagactagtatctgcatgaaattttttcgttacaagtgtctgcat |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32751816 |
agcagaacttgtgactgcttataaatcatttgatgatcatgtgtgtgtgcgtgtgtagactagtatctgcatgaaattttttcgttacaagtatctgcat |
32751717 |
T |
 |
| Q |
109 |
gaa |
111 |
Q |
| |
|
||| |
|
|
| T |
32751716 |
gaa |
32751714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 65 - 190
Target Start/End: Complemental strand, 32746515 - 32746389
Alignment:
| Q |
65 |
agactagtatctgcatgaaattttttcgttacaagtgtctgcatgaatcgtagag--nnnnnnnnnnctattagaaaatagacttaatgatgtatagtca |
162 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||||||||| ||||| |||||| | ||||||||||||| ||| |||||||||||| |
|
|
| T |
32746515 |
agactagtatctgcatgattttttctggttacaagtgtctgcttgaattgtagagttttttttttgtcaattagaaaataga-ataacgatgtatagtca |
32746417 |
T |
 |
| Q |
163 |
atgaaggtttgtcctgttggcaagtatt |
190 |
Q |
| |
|
|||||||||||||| |||||||| |||| |
|
|
| T |
32746416 |
atgaaggtttgtccagttggcaattatt |
32746389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 70 - 99
Target Start/End: Complemental strand, 32751727 - 32751698
Alignment:
| Q |
70 |
agtatctgcatgaaattttttcgttacaag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32751727 |
agtatctgcatgaaattttttcgttacaag |
32751698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University