View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_low_17 (Length: 420)
Name: NF5761_low_17
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_low_17 |
 |  |
|
| [»] scaffold0237 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 352; Significance: 0; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 53 - 416
Target Start/End: Original strand, 52824040 - 52824403
Alignment:
| Q |
53 |
tttgtttattgtcaggaagatagagcgattgtgtgcaaagagtgtgatttgaaggttcatggtgtcaacgaacacaccaagaagcataataggtttcttc |
152 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824040 |
tttgttttttgtcaggaagatagagcgattgtgtgcaaagagtgtgatttgaaggttcacggtgtcaacgaacacaccaagaagcataataggtttcttc |
52824139 |
T |
 |
| Q |
153 |
taagtgggatcaagctgcactctcctgctcctcctcccactcttcatgaagaaactggtaattttactatatctgagtacttgataaacactatcccagg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824140 |
taagtgggatcaagctgcactctcctgctcctcctcccactcttcatgaagaaactggtaattttactatatctgagtacttgataaacactatcccagg |
52824239 |
T |
 |
| Q |
253 |
ttggaagtttgaagatttccttgattccccttcttcttctgttccctctcatgaactacaacaccagaatcatatagtgcatgatgatgctaattatcat |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824240 |
ttggaagtttgaagatttccttgattccccttcttcttctgttccctctcatgaactacaacaccagaatcatatagtgcatgatgatgctaattatcat |
52824339 |
T |
 |
| Q |
353 |
attcatgaggaaaatattctggtttctttctctagcgagagcatgcgtaggatctgtgctcctc |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52824340 |
attcatgaggaaaatattctggtttctttctctagcgagagcatgcgtaggatctgtgttcctc |
52824403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 48587053 - 48587016
Alignment:
| Q |
18 |
atatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48587053 |
atatgggaataaagggtgtctatgtatcattactcttt |
48587016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 33644349 - 33644385
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33644349 |
tatgggaataaagggtgtctatgtatcattactcttt |
33644385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 49607563 - 49607592
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49607563 |
tatgggaataaagggtgtctatgtatcatt |
49607592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 53982160 - 53982189
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53982160 |
tatgggaataaagggtgtctatgtatcatt |
53982189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 32869827 - 32869868
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctctttgttta |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
32869827 |
tatgggaataaagggtgtctatgtatcattactcttttttta |
32869868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 29857976 - 29858021
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctctttgtttattgt |
64 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||| ||| |||| |
|
|
| T |
29857976 |
tatgggaataaatggtgtctatgtatcattactcttttttttttgt |
29858021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 7465686 - 7465649
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctctttg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7465686 |
tatgggaataaagggtgtctatgtatcattactctttg |
7465649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 28381606 - 28381572
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
28381606 |
tatgggaataaagggtgtctatgtatcattactct |
28381572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 5574451 - 5574422
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5574451 |
tatgggaataaagggtgtctatgtatcatt |
5574422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 13438492 - 13438521
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13438492 |
tatgggaataaagggtgtctatgtatcatt |
13438521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 17473169 - 17473198
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17473169 |
tatgggaataaagggtgtctatgtatcatt |
17473198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 28863604 - 28863633
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28863604 |
tatgggaataaagggtgtctatgtatcatt |
28863633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 19930771 - 19930735
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
19930771 |
tatgggaataaaaggtgtctatgtatcattactcttt |
19930735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 14548071 - 14548107
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14548071 |
tatgggaataaagggtgtctatgtatcattactcttt |
14548107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 34012242 - 34012203
Alignment:
| Q |
24 |
gaataaagggtgtctatgtatcattcctctttgtttattg |
63 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
34012242 |
gaataaagggtgtctatgtatcattactctttttttattg |
34012203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 19329991 - 19330027
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19329991 |
tatgggaataaagggtgtctatgtatcattactcttt |
19330027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 8080334 - 8080300
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
8080334 |
tatgggaataaagggtgtctatgtatcattactct |
8080300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 3434701 - 3434730
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3434701 |
tatgggaataaagggtgtctatgtatcatt |
3434730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 38837366 - 38837402
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
38837366 |
tatggaaataaagggtgtctatgtatcattactcttt |
38837402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 2740423 - 2740467
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctctt-tgtttatt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
2740423 |
tatgggaataaagggtgtctatgtatcattactcttctgtttatt |
2740467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 33149584 - 33149545
Alignment:
| Q |
24 |
gaataaagggtgtctatgtatcattcctctttgtttattg |
63 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
33149584 |
gaataaagggtgtctatgtatcattactctttttttattg |
33149545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 57
Target Start/End: Original strand, 14831963 - 14832001
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctctttgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
14831963 |
tatgggaataaagggtgtctatgtatcattactcgttgt |
14832001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 40145555 - 40145592
Alignment:
| Q |
18 |
atatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
40145555 |
atatgagaataaagggtgtctatgtatcattactcttt |
40145592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 16115283 - 16115247
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
16115283 |
tatgagaataaagggtgtctatgtatcattactcttt |
16115247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 24995058 - 24995024
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
24995058 |
tatgggaataaagggtgtctatgtatcattactct |
24995024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 41236496 - 41236530
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
41236496 |
tatgggaataaagggtgtctatgtatcattactct |
41236530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 42044318 - 42044282
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
42044318 |
tatggaaataaagggtgtctatgtatcattactcttt |
42044282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 26274578 - 26274612
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
26274578 |
tatgggaataaagggtgtctatgtatcattactct |
26274612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 27564686 - 27564652
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
27564686 |
tatgggaataaagggtgtctatgtatcattactct |
27564652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 37649347 - 37649376
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37649347 |
tatgggaataaagggtgtctatgtatcatt |
37649376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 48716233 - 48716204
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48716233 |
tatgggaataaagggtgtctatgtatcatt |
48716204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0237 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0237
Description:
Target: scaffold0237; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 4178 - 4214
Alignment:
| Q |
19 |
tatgggaataaagggtgtctatgtatcattcctcttt |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
4178 |
tatgggaataaatggtgtctatgtatcattactcttt |
4214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University