View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_low_33 (Length: 294)
Name: NF5761_low_33
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 255
Target Start/End: Original strand, 37716223 - 37716463
Alignment:
| Q |
16 |
atcggaac-gagacccatatgcagtgagtaaaattggtggtaacaagttggtgaaatagtcccaataatataagatcaaatcaagcaagcactatgctgc |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37716223 |
atcggaactgagacccatatgcagtgagtaaatttggtggtaacaagttggtgaaatagtcccaataatataagatcaaatcaagcaagcactatgctgc |
37716322 |
T |
 |
| Q |
115 |
tgacctttttgtgaaattaagatgaaatcttcttcaagacttggaagatcttcatcttcattatcaataacatcttctacttacttgatacatgtcttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37716323 |
tgacctttttgtgaaattaagatgaaatcttcttcaagacttggaagatcttcatcttcattatcaataacatcttctacttacttgatacatgtcttca |
37716422 |
T |
 |
| Q |
215 |
aaactctaaatcactgataaacctagtttctcacaattatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37716423 |
aaactctaaatcactgataaacctagtttctcacaattatt |
37716463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University