View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_low_35 (Length: 266)
Name: NF5761_low_35
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 51 - 250
Target Start/End: Complemental strand, 51190385 - 51190186
Alignment:
| Q |
51 |
catgaacttgttcttcttgatcatgaagaaggtggaagcagcaatgttacaaagtggaagcaagaacaacctttgcatatgattaatcataaaatattga |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51190385 |
catgaacttgttcttcttgatcatgaagaaggtggaagcagcaatgttacaaagtggaagcaagaacaaactttgcatatgattaatcataaaatattga |
51190286 |
T |
 |
| Q |
151 |
tctctgatgttgttacaaggagtaggtggagtgatcttaattcttcagatttgttatcattgaatagtgaaatgcttcatgatatgtcaagcactagatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51190285 |
tctctgatgttgttacaaggagtaggtggagtgatcttaattcttcagatttgttatcattgaatagtgaaatgcttcatgatatgtcaagcactagatt |
51190186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University