View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_low_41 (Length: 239)
Name: NF5761_low_41
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 209
Target Start/End: Complemental strand, 39304910 - 39304724
Alignment:
| Q |
24 |
accaccccctgagaaaaacttactctaccatgtcatagccatgctcccatcatcaagcttaaggacgtcaaaatgtttacaacgttctcataaacataac |
123 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39304910 |
accaccccctcagaaaaacttactctaccatgtcatagccatgctcccatcatcaagcttaaggacgtcaaaatgtttacaacgttctcataaacataac |
39304811 |
T |
 |
| Q |
124 |
tatatcattgcatgaagatcaatattaaacacaatgaaggatatgaacaccaatcaaaaca-ttttcaattcatataaaaaacagaa |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39304810 |
tatatcattccatgaagatcaatattaaacacaatgaaggatatggacaccaatcaaaacatttttcaattcatataaaaaacagaa |
39304724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University