View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_low_43 (Length: 238)
Name: NF5761_low_43
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 44990695 - 44990482
Alignment:
| Q |
1 |
tggttttgatgctttttgttttcttttcgtaataaggaccaaatgacatagtttaagaacaatatttagggacattttctaatgtacttctgggattgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44990695 |
tggttttgatgctttttgttttcttttcgtaataaggaccaaatgacgtagtttaagaacaatatttagggacattttctaatgtacttatgggattgtt |
44990596 |
T |
 |
| Q |
101 |
ccaaaaacatatacttaaatagttttgttcataatttaaaacttaaatgcaataggttgtttttgagttttgttgttgcatctttgagattcgctaagca |
200 |
Q |
| |
|
|||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44990595 |
ccaaaaacgt--------gtatttttgttcataatttaaaacttaaatgcaataggttgtttttgagttttgttgttgcatctttgagattctctaagca |
44990504 |
T |
 |
| Q |
201 |
tcattatgcaacatcaacattt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44990503 |
tcattatgcaacatcaacattt |
44990482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University