View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_low_49 (Length: 225)
Name: NF5761_low_49
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 31 - 208
Target Start/End: Original strand, 20360015 - 20360192
Alignment:
| Q |
31 |
aaacaatattaccacatagtctattttgcaattttgttttattaaaaataattattgaaaacataggattacattgcagacccatctgtattggctttaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
20360015 |
aaacaatattaccacatagtctattttacaattttgttttattaaaaataattattgaaaccataggattacgttgcaaacccatctgtattggctttaa |
20360114 |
T |
 |
| Q |
131 |
tccaattgaaaacatgatttatctaaagaattcaaaatttgaacatcttcattgtgttaagaactatatccagtggag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20360115 |
tccaattgaaaacatgatttatctaaagaattcaaaatttgaacatcttcattgtattaagaactatatccagtggag |
20360192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University