View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5761_low_51 (Length: 219)

Name: NF5761_low_51
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5761_low_51
NF5761_low_51
[»] chr7 (1 HSPs)
chr7 (129-203)||(35880959-35881033)


Alignment Details
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 35880959 - 35881033
Alignment:
129 aagaagaagatgtcgaagttattcgacgggtttaacgttttcatatcgcgacacttatttccacctcgtgaattt 203  Q
    |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
35880959 aagatgaagacgtcgaagttattcgacgggtttaacgttttcatatcgcgacacttatttccacctcatgaattt 35881033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University