View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5761_low_52 (Length: 215)
Name: NF5761_low_52
Description: NF5761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5761_low_52 |
 | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 59347 - 59524
Alignment:
| Q |
19 |
aatatgaaggcgaaggcacttaaagagtgtgaagttcacacaaataaatatgctgaatgtatgattgggagaacactttctgttggttggtggagttgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59347 |
aatatgaaggcgaaggcacttaaagagtgtgaagttcacacaaataaatatgctgaatgtatgattgggagaacactttctgttggttggtggagttgtt |
59446 |
T |
|
| Q |
119 |
cgaaagaagctaaagactttaaaaaatgtcttcgtcaattgtaagctaagctgtcttatgaaatactataattattct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59447 |
cgaaagaagctaaagactttaaaaaatgtcttcgtcaattgtaagctaagctgtcttatgaaatactataattattct |
59524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 22 - 108
Target Start/End: Complemental strand, 20890 - 20804
Alignment:
| Q |
22 |
atgaaggcgaaggcacttaaagagtgtgaagttcacacaaataaatatgctgaatgtatgattgggagaacactttctgttggttgg |
108 |
Q |
| |
|
||||||| ||| ||||||||||||||||| | ||||||| ||||||||||| ||| || ||||||||||||||||||| |||| |
|
|
| T |
20890 |
atgaaggtgaaagcacttaaagagtgtgattattacacaaagaaatatgctgagtgtgctatggggagaacactttctgttgtttgg |
20804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University