View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5763_high_28 (Length: 239)
Name: NF5763_high_28
Description: NF5763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5763_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 27722076 - 27722302
Alignment:
| Q |
1 |
caactcaatttgaaactcttgtagtatcacggtggaacaaattttggtagaacaacctcagcctttacaacaacacgttactacgacgaagctcctcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27722076 |
caactcaatttgaaactcttgtagtatcacggtggaacaaattttggtagaacaacctcagcctttacaacaacacgttactacgacgaagctcctcttg |
27722175 |
T |
 |
| Q |
101 |
atgagtttggcctacaaagagaaccaaaatggagtcacctaagggatgcgcacaaggctgtaaacctatgtaagaagtctctactcaatggtgtgcctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27722176 |
atgagtttggcctacaaagagaaccaaaatggagtcacctaagggatgcgcacaaggctgtaaacctatgtaagaagtctctactcaatggtgtgcctac |
27722275 |
T |
 |
| Q |
201 |
cacacaaaaaattagccagtatgatga |
227 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
27722276 |
cacacaaaaaattagccagtatcatga |
27722302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 55173111 - 55173038
Alignment:
| Q |
31 |
ggtggaacaaattttggtagaacaacctcagcctttacaacaacacgttactacgacgaagctcctcttgatga |
104 |
Q |
| |
|
||||||||||| ||||| ||||||||||| |||||||||||||| ||||| ||||| || || ||||||||||| |
|
|
| T |
55173111 |
ggtggaacaaactttggaagaacaacctctgcctttacaacaacccgttattacgatgaggcacctcttgatga |
55173038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University