View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5763_low_16 (Length: 307)
Name: NF5763_low_16
Description: NF5763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5763_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 12 - 293
Target Start/End: Original strand, 43260834 - 43261115
Alignment:
| Q |
12 |
gaatatagtataaattaaatcttagtagtttattggtttcaatttcagacaattgtttactacttctgatggtggaacccttgctttggactgggtaacg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43260834 |
gaatatagtataaattaaatcttagtagtttattggtttcaatttcagacaattgtttactacttctgatggtggaacccttgctttggactgggtaacg |
43260933 |
T |
 |
| Q |
112 |
agttctgatggtatgtatattcaaatttatttataaatttgtgtttttaaaatgcatagttaatttagtatcaaattagaaagccttcgatgacctttca |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43260934 |
agttctgatggtatgtatattcaaattaatttataaatttttgtttttaaaatgcatagttaatttagtatcaaattagaaagccttcgatgacctttca |
43261033 |
T |
 |
| Q |
212 |
gatttttgtgtctgattattattatgttacagtttctggcagcgttcaccatgacgatgatgttgttactaaagatgattct |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43261034 |
gatttttgtgtctgattattattatgttacagtttctggcagcgttcaccatgacgatgatgttgttactaaagatgattct |
43261115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 52 - 107
Target Start/End: Original strand, 43271039 - 43271094
Alignment:
| Q |
52 |
aatttcagacaattgtttactacttctgatggtggaacccttgctttggactgggt |
107 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
43271039 |
aatttcagacaattgtttaatactcctgatggtggaactattgctctggactgggt |
43271094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University