View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5763_low_20 (Length: 288)
Name: NF5763_low_20
Description: NF5763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5763_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 9 - 201
Target Start/End: Original strand, 30607925 - 30608117
Alignment:
| Q |
9 |
gattatacttaacgtggtagtgaagttatatttggtcatttgagacaagaaatatcaatatcacaaagggatagttctattagataagcttttgagcaca |
108 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30607925 |
gattattcttaacgtggtagtgaaattatatttggtcatttgagacaagaaatatcaatatcacaaagggatagttctattagataagctttagagcaca |
30608024 |
T |
 |
| Q |
109 |
atgctaagttgtatattagatcatcgggcatatagataatcccttattccttagagtaattttgattctaaagtggttgattagactctggaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30608025 |
atgctaagttgtatattagatcatcgggcatatagataatcccttattccttagagtaattttgattctaaagtggttgattagactctggaa |
30608117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 16102590 - 16102637
Alignment:
| Q |
28 |
gtgaagttatatttggtcatttgagacaagaaatatcaatatcacaaa |
75 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
16102590 |
gtgaagttatatttggtcatttgggacactaaagatcaatatcacaaa |
16102637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University