View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5765-Insertion-7 (Length: 291)
Name: NF5765-Insertion-7
Description: NF5765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5765-Insertion-7 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 8 - 291
Target Start/End: Complemental strand, 43291819 - 43291536
Alignment:
| Q |
8 |
catacttcatgtctagagtcaacatgtccaacatataatatatttcactactttgagggtgcttctcatctctagatacaaagcagttaacaaacccagc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43291819 |
catacttcatgtctagagtcaacatgtccaacatataatatatttcactactttgagggtgcttctcatctctagatacaaagcagtttacaaacccagc |
43291720 |
T |
|
| Q |
108 |
tatctcaacccaactacatcccgtttccttgtgcagacctttttctttcatctgctttctcactctatcaactttttcccactttccttcctcagcataa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43291719 |
aatctcaacccaactacatcccgtttccttgtgcagacctttttctttcatctgctttctcactctatcaactttttcccactctccttcctcagcataa |
43291620 |
T |
|
| Q |
208 |
atattcgagagcagaacatgatatcctgccattcttttatccattcccatattcagcaattttttagcaacagcttttcctaat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43291619 |
atattcgagagcagaacatgatatcctgccattcttttatccattcccatattcagcaattttttagcaacagcttttcctaat |
43291536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 43308191 - 43308139
Alignment:
| Q |
160 |
tgctttctcactctatcaactttttcccactttccttcctcagcataaatatt |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||| |||||||||| |
|
|
| T |
43308191 |
tgctttgtcactctatcaactttttcccactcacctccctctccataaatatt |
43308139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University