View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5765-Insertion-9 (Length: 74)
Name: NF5765-Insertion-9
Description: NF5765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5765-Insertion-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 21 - 74
Target Start/End: Complemental strand, 1861599 - 1861546
Alignment:
| Q |
21 |
caggaccaagcagtagtgatgctgtttcttttggttcaatccttggtgccactc |
74 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1861599 |
caggaccaaacagtagtgatgctgtttcttttggttcaatccttggtgccactc |
1861546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 69
Target Start/End: Original strand, 52501149 - 52501186
Alignment:
| Q |
32 |
agtagtgatgctgtttcttttggttcaatccttggtgc |
69 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
52501149 |
agtagtgatgctgtttatcttggttcaatccttggtgc |
52501186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University