View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5765_high_1 (Length: 404)
Name: NF5765_high_1
Description: NF5765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5765_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 235 - 389
Target Start/End: Complemental strand, 29296566 - 29296417
Alignment:
| Q |
235 |
gaagcagcaaaaccaggcctagtaggtatgtgttgtttccctctcaaaaaaagnnnnnnnnnnctttaattgaagctggtgtatatagttaaagaacatt |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29296566 |
gaagcagcaaaaccaggcctagtaggtatgtgttgtttccctctcaat-----tttttttcttctttaattgaagctggtgtatatagttaaagaacatt |
29296472 |
T |
 |
| Q |
335 |
gtttagacgttaaattttgaactcagttttgaattgaaaggtatagttgaaaagt |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29296471 |
gtttagacgttaaattttgaactcagttttgaattgaaatgtatagttgaaaagt |
29296417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 29296800 - 29296705
Alignment:
| Q |
1 |
taatgatcggtattagttactttacgctctaatgcaagttttgttttttgaatggacactctaatgtaagttggtcactttagaggagcataattc |
96 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29296800 |
taatgatcagtattagttactttacgctttaatgcaagttttgttttttgaatgggcactctaatgtaagttggtcactttagaggcgcataattc |
29296705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University