View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5765_low_12 (Length: 229)
Name: NF5765_low_12
Description: NF5765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5765_low_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 53660892 - 53661120
Alignment:
| Q |
1 |
aacgtatatatggcttaagtgcaacgtggatgtggatttccaacaggaagataggtccacttcttttggatgttgtgctcatgattctgatggttgattc |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53660892 |
aacgtatatatggcttaagtgcaacatggatgtggatttccaacaggaagataggtccacttcttttggatgttgcgctcatgattctgatggttgattc |
53660991 |
T |
|
| Q |
101 |
atgacggcacatgnnnnnnnnnnnnnnnnnatggagacatggccatatgtcgttgcttgaaggcgaggcttccgctcttcttgaagcaaccaagttcact |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660992 |
atgacggcacatgacacacacacacacacaatggagacatggccatatgtcgttgcttgaaggcgaggcttccgctcttcttgaagcaaccaagttcact |
53661091 |
T |
|
| Q |
201 |
cataccaaagaatgtgagtgtgtgatttt |
229 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
53661092 |
cgtaccaaagaatgtgagtgtgtgatttt |
53661120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 146 - 199
Target Start/End: Complemental strand, 10244932 - 10244879
Alignment:
| Q |
146 |
tatgtcgttgcttgaaggcgaggcttccgctcttcttgaagcaaccaagttcac |
199 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||||||||||| || |||||| |
|
|
| T |
10244932 |
tatgtcggtgcttgaaggcgaagcttcagctcttcttgaagcaatcaggttcac |
10244879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University