View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5767-Insertion-5 (Length: 254)
Name: NF5767-Insertion-5
Description: NF5767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5767-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 254
Target Start/End: Original strand, 2367127 - 2367373
Alignment:
| Q |
8 |
ctataagtacctcatttccgtttcaccttcaaacatgtcacaccgcgctccgaggtattgtcctctttaggtgtaagctcttcacggttttaacgaaaga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2367127 |
ctataagtacctcttttccgtttcaccttcaaacatgtcacaccgcgttccgaggtattgtcctctttaggtgtaagctcttcacggttttaacgaaaga |
2367226 |
T |
|
| Q |
108 |
cgaatcgttgtattgtatataaactacccttggttaatgttccattccactcacaagtacaccacatcatcttctcaggtattgtccactttgggtcgtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2367227 |
cgaatcgttgtattgtatataaactaccgttggttaatgttccattccactcacaagtacaccacatcatcttctcaggtattgtccactttgggttgtt |
2367326 |
T |
|
| Q |
208 |
gagtgacctttcacagttttgtctgttataaaaagtgtctatttgga |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2367327 |
gagtgacctttcacagttttgtctgttataaaaagtgtctagttgga |
2367373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University