View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5767_high_10 (Length: 282)
Name: NF5767_high_10
Description: NF5767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5767_high_10 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 140 - 271
Target Start/End: Original strand, 2125 - 2256
Alignment:
| Q |
140 |
ttgttccaatacattctttttcaagtttcacagtttctttatctgccatcaacaacaaccatgtatcagaatcatcttcttctgattcttcttccaactc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2125 |
ttgttccaatacattctttttcaagtttcccagtttctttatctgccatcaacaacagccatgtatcagaatcatcttcttctgattcttcttccaactt |
2224 |
T |
|
| Q |
240 |
tcttcttgaatatgatttctaccgtgattcat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2225 |
tcttcttgaatatgatttctaccgtgattcat |
2256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 77
Target Start/End: Original strand, 1998 - 2062
Alignment:
| Q |
13 |
aaaatggcaccaccattgatactaccaaaattaattcttctgattcttgtgttatgtcttttatt |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1998 |
aaaatggcaccaccattgatactaccaaaattaattcttctgattcttgtgttatgtcttttatt |
2062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 140 - 271
Target Start/End: Original strand, 3451344 - 3451475
Alignment:
| Q |
140 |
ttgttccaatacattctttttcaagtttcacagtttctttatctgccatcaacaacaaccatgtatcagaatcatcttcttctgattcttcttccaactc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451344 |
ttgttccaatacattctttttcaagtttcccagtttctttatctgccatcaacaacagccatgtatcagaatcatcttcttctgattcttcttccaactt |
3451443 |
T |
|
| Q |
240 |
tcttcttgaatatgatttctaccgtgattcat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3451444 |
tcttcttgaatatgatttctaccgtgattcat |
3451475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 77
Target Start/End: Original strand, 3451217 - 3451281
Alignment:
| Q |
13 |
aaaatggcaccaccattgatactaccaaaattaattcttctgattcttgtgttatgtcttttatt |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451217 |
aaaatggcaccaccattgatactaccaaaattaattcttctgattcttgtgttatgtcttttatt |
3451281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University