View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5767_low_12 (Length: 244)
Name: NF5767_low_12
Description: NF5767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5767_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 40271778 - 40272002
Alignment:
| Q |
1 |
gaaacagaagaaggtttcggatgttagggattttaggttattggttgctcagattaaggtgatggaagggaatttttcagaggcgcttaaagcttatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40271778 |
gaaacagaagaaggtttcggatgttagggattttaggttattggttgctcagattaaggtgatggaagggaatttttcagaggcgcttaaagcttatcag |
40271877 |
T |
 |
| Q |
101 |
gatttggtgaaagaagaacctagagattttaggccttatctgtgtcagggtattatatatacattgcttagaaagaaagatgaagcggagaagcaattcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40271878 |
gatttggtgaaagaagaacctagagattttaggccttatctgtgtcagggtattatatatacattgcttagaaagaaagatgaagccgagaagcaattcg |
40271977 |
T |
 |
| Q |
201 |
atcagttccggaagcttgtcccgaa |
225 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
40271978 |
atcagttccgaaagcttgtcccgaa |
40272002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University