View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5767_low_16 (Length: 237)
Name: NF5767_low_16
Description: NF5767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5767_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 27184683 - 27184859
Alignment:
| Q |
1 |
ttctctttttaggattagtatttagttatttatctatcttcccaaagtttaaaatggagtgaaaattacaccaactacataatgtaagatttgtttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27184683 |
ttctctttttaggattagtatttagttatttatctatcttcccaaagtttaaaatggagtgaaaattacaccaactacataatgtaagatttgtttgttg |
27184782 |
T |
|
| Q |
101 |
agagaaaggatgaaagattgttgtagagacaacttcacttcgaatacttggaaaattattaaagaagattttgatga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
27184783 |
agagaaaggatgaaagattgttgtagagacaacttcacttcgaatactcggaaaatgattaaagaagattttgatga |
27184859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 82 - 177
Target Start/End: Original strand, 28068778 - 28068873
Alignment:
| Q |
82 |
atgtaagatttgtttgttgagagaaaggatgaaagattgttgtagagacaacttcacttcgaatacttggaaaattattaaagaagattttgatga |
177 |
Q |
| |
|
|||||||||| |||| |||||| ||||||| |||||||||||||||| ||||||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
28068778 |
atgtaagattggttttttgagaaaaaggattaaagattgttgtagaggcaacttcactttatatacttggaaaaggattaaagaatattttgatga |
28068873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University