View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5767_low_6 (Length: 392)

Name: NF5767_low_6
Description: NF5767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5767_low_6
NF5767_low_6
[»] chr3 (6 HSPs)
chr3 (6-377)||(34376891-34377256)
chr3 (6-377)||(35976384-35976753)
chr3 (196-326)||(12879057-12879187)
chr3 (17-81)||(12879193-12879257)
chr3 (142-227)||(10378483-10378569)
chr3 (341-370)||(19185014-19185043)
[»] chr6 (1 HSPs)
chr6 (280-325)||(7889857-7889902)
[»] chr1 (3 HSPs)
chr1 (279-326)||(28892984-28893032)
chr1 (341-369)||(21487948-21487976)
chr1 (143-191)||(35142323-35142371)
[»] chr2 (2 HSPs)
chr2 (143-186)||(31326590-31326633)
chr2 (341-369)||(15703458-15703486)
[»] scaffold0005 (1 HSPs)
scaffold0005 (341-371)||(282274-282304)
[»] scaffold0001 (1 HSPs)
scaffold0001 (341-371)||(56624-56654)
[»] scaffold0062 (1 HSPs)
scaffold0062 (341-369)||(52370-52398)
[»] chr7 (1 HSPs)
chr7 (341-377)||(980858-980894)


Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 6 - 377
Target Start/End: Complemental strand, 34377256 - 34376891
Alignment:
6 cataggccgttgttgatgtttgtggctgaaccaatggtcccttactctaatattcatagatggtattggaatcctacgttagttccgtttgctcttcgca 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||    
34377256 cataggccgttgttgatgtttgtggctgaaccaatggtcccttactctaatattcatagatagtattggaatcctacgttagttctgtttgctcttcgca 34377157  T
106 ataggtgccataatggtaatcaaggcgacatttccactttcatctcatattttccccgaagggaattgttgtgcggataagcttgcgcatcatggtcaca 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
34377156 ataggtgccataatggtaatcaaggcgacatttccactttcatctcatattttctccgaagggaattgttgtgcggataagcttgcgcatcatggtcaca 34377057  T
206 gcttggatgttgtttttggtgggaggcttccccattgtttattagaggtgattttgttagagacatgtacggattttccgttatccttaggtctcttgct 305  Q
    |   ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
34377056 g---ggatgttgtttttggtgggaggcttccccattgtttattagagatgattttgttagagacatgtacggattttccgttatccttaggtctcttgct 34376960  T
306 ttgattttggctttttgtttcatgnnnnnnnnnnnagggttttggtctagtcccccctcttgtatagttttt 377  Q
    ||| ||||||||||||||||| ||           ||| |||||||||||||||||||||||||||||||||    
34376959 ttgtttttggctttttgtttcctg---ttttttttaggattttggtctagtcccccctcttgtatagttttt 34376891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 6 - 377
Target Start/End: Original strand, 35976384 - 35976753
Alignment:
6 cataggccgttgttgatgtttgtggctgaaccaatggtcccttactctaatattcatagatggtattggaat---cctacgttagttccgtttgctcttc 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||| |||||||||||    
35976384 cataggccgttgttgatgtttgtggctgaaccaatggtcccttactctaatattcatagatggtattggaataatcctacgttagttctgtttgctcttc 35976483  T
103 gcaataggtgccataatggtaatcaaggcgacatttccactttcatctcatattttccccgaagggaattgttgtgcggataagcttgcgcatcatggtc 202  Q
    |||||||||| |||||| | |||||||||| ||||||||||||||||||||||||| | ||||||||||||||||| ||||||||||| | |||||||||    
35976484 gcaataggtggcataattgcaatcaaggcggcatttccactttcatctcatatttttctcgaagggaattgttgtgtggataagcttgtgaatcatggtc 35976583  T
203 acagcttggatgttgtttttggtgggaggcttccccattgtttattagaggtgattttgttagagacatgtacggattttccgttatccttaggtctctt 302  Q
    ||| |||||||||||||||||||||||||||| |||||||||||| |||| |||||||  ||||||||   |||||||||||||||||||||||||||||    
35976584 acaacttggatgttgtttttggtgggaggctttcccattgtttatgagagatgatttttatagagaca-acacggattttccgttatccttaggtctctt 35976682  T
303 gctttgattttggctttttgtttcatgnnnnnnnnnnnagggttttggtctagtcccccctcttgtatagttttt 377  Q
    ||||| |||||||| ||||||||| |            |||||||||||||||||| ||||||||||||||||||    
35976683 gctttcattttggccttttgtttcct----ttcttcttagggttttggtctagtcctccctcttgtatagttttt 35976753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 196 - 326
Target Start/End: Complemental strand, 12879187 - 12879057
Alignment:
196 catggtcacagcttggatgttgtttttggtgggaggcttccccattgtttattagaggtgattttgttagagacatgtacggattttccgttatccttag 295  Q
    |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||||  ||||||||| ||| |||||||||||||||||||    
12879187 catggtcacaacttggatgttgtttttggtgggaggctttcccattgtttattagagatgatttttatagagacatatacagattttccgttatccttag 12879088  T
296 gtctcttgctttgattttggctttttgtttc 326  Q
     |||||||||||||||||||| |||||||||    
12879087 atctcttgctttgattttggcattttgtttc 12879057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 17 - 81
Target Start/End: Complemental strand, 12879257 - 12879193
Alignment:
17 gttgatgtttgtggctgaaccaatggtcccttactctaatattcatagatggtattggaatccta 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12879257 gttgatgtttgtggctgaaccaatggtcccttactctaatattcatagatggtattggaatccta 12879193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 10378569 - 10378483
Alignment:
142 ctttcatctcatattttccccgaagggaattgttgtgcggataagcttgcgcatcatggtcacagcttggatgttgtt-tttggtgg 227  Q
    ||||||||||||||||| | |||||| ||||||||| | |||||| | ||  |||||||||||| ||||| || |||| ||||||||    
10378569 ctttcatctcatatttttcgcgaaggaaattgttgtacagataagttagcaaatcatggtcacaacttggttgatgttatttggtgg 10378483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 370
Target Start/End: Original strand, 19185014 - 19185043
Alignment:
341 agggttttggtctagtcccccctcttgtat 370  Q
    ||||||||||||||||||||||||||||||    
19185014 agggttttggtctagtcccccctcttgtat 19185043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 325
Target Start/End: Complemental strand, 7889902 - 7889857
Alignment:
280 tttccgttatccttaggtctcttgctttgattttggctttttgttt 325  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||    
7889902 tttccgttatccttaggtctctagctttgtttttggctttttgttt 7889857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 279 - 326
Target Start/End: Complemental strand, 28893032 - 28892984
Alignment:
279 ttttccgttatccttaggtctcttgctttg-attttggctttttgtttc 326  Q
    ||||| |||||| ||||||||||||||||| ||||||||||||||||||    
28893032 ttttctgttatcattaggtctcttgctttgcattttggctttttgtttc 28892984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 341 - 369
Target Start/End: Complemental strand, 21487976 - 21487948
Alignment:
341 agggttttggtctagtcccccctcttgta 369  Q
    |||||||||||||||||||||||||||||    
21487976 agggttttggtctagtcccccctcttgta 21487948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 143 - 191
Target Start/End: Original strand, 35142323 - 35142371
Alignment:
143 tttcatctcatattttccccgaagggaattgttgtgcggataagcttgc 191  Q
    |||| |||||||||||||  ||||| |||||||||||||||||| ||||    
35142323 tttcctctcatattttccgtgaaggtaattgttgtgcggataagtttgc 35142371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 143 - 186
Target Start/End: Complemental strand, 31326633 - 31326590
Alignment:
143 tttcatctcatattttccccgaagggaattgttgtgcggataag 186  Q
    |||||||||||||||| | |||||| ||||||||||||||||||    
31326633 tttcatctcatatttttcgcgaaggaaattgttgtgcggataag 31326590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 341 - 369
Target Start/End: Original strand, 15703458 - 15703486
Alignment:
341 agggttttggtctagtcccccctcttgta 369  Q
    |||||||||||||||||||||||||||||    
15703458 agggttttggtctagtcccccctcttgta 15703486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 341 - 371
Target Start/End: Original strand, 282274 - 282304
Alignment:
341 agggttttggtctagtcccccctcttgtata 371  Q
    |||||||||||||||||||||||||||||||    
282274 agggttttggtctagtcccccctcttgtata 282304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 341 - 371
Target Start/End: Original strand, 56624 - 56654
Alignment:
341 agggttttggtctagtcccccctcttgtata 371  Q
    |||||||||||||||||||||||||||||||    
56624 agggttttggtctagtcccccctcttgtata 56654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0062
Description:

Target: scaffold0062; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 341 - 369
Target Start/End: Original strand, 52370 - 52398
Alignment:
341 agggttttggtctagtcccccctcttgta 369  Q
    |||||||||||||||||||||||||||||    
52370 agggttttggtctagtcccccctcttgta 52398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 341 - 377
Target Start/End: Original strand, 980858 - 980894
Alignment:
341 agggttttggtctagtcccccctcttgtatagttttt 377  Q
    ||||| ||||||||||||||||||||||||| |||||    
980858 agggtattggtctagtcccccctcttgtatatttttt 980894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University