View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5768-Insertion-4 (Length: 96)
Name: NF5768-Insertion-4
Description: NF5768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5768-Insertion-4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 4e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 41829932 - 41830020
Alignment:
| Q |
8 |
acttacacgatcatgtatatgtgtttgacttttatttcagacctacctgtttattgttaatttgtaaacttatatactcctttcgtata |
96 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41829932 |
acttacacgatcatgtatatatgtttgacttttatttcagacctacctgtttattgttaatttgtaaacttatatactcctttcgtata |
41830020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University