View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5768_high_12 (Length: 369)
Name: NF5768_high_12
Description: NF5768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5768_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 118 - 365
Target Start/End: Original strand, 20287794 - 20288041
Alignment:
| Q |
118 |
cccatgtaattaatcacctgcaggcaatttatttgttgtcaaacccaaatgggtctatgaagctttacgagtttgtgatcatatttggttgcttcatgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20287794 |
cccatgtaattaatcacctgcaggcagtttatttgttgtcaaacccaaatgggtctatgaagctttacgagtttgtgatcatatttggttgcttcatgtt |
20287893 |
T |
 |
| Q |
218 |
gattttggctcaaatcccatcttttcactcattgaggcacattaatcttgtgtctttggttctatgcttactctatagtgcttgtgctgctgctggttct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20287894 |
gattttggctcaaatcccatcttttcactcattgagacacattaatcttgtgtctttggttctatgcttactctatagtgcttgtgctgctgctggttct |
20287993 |
T |
 |
| Q |
318 |
atatatattggtatttgcaaaaataaattacatactcctttgctactc |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20287994 |
atatatattggtatttgcaaaaataaattacatactcctttgttactc |
20288041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 17 - 78
Target Start/End: Original strand, 20287691 - 20287754
Alignment:
| Q |
17 |
acccttgtgatacacatactcatatagac--acattttttacatgccctaaccatattgttacc |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20287691 |
acccttgtgatacacacactcatatagactcacattttttacatgccctaaccatattgttacc |
20287754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University