View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5768_high_15 (Length: 361)
Name: NF5768_high_15
Description: NF5768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5768_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 325; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 11 - 347
Target Start/End: Original strand, 43244781 - 43245117
Alignment:
| Q |
11 |
cagagaacctttggaccatatggagttgaagaagggacaccattcactttctcaatagatggaggccaggttgtgggttttaagggacgaggtgattggt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244781 |
cagagaacctttggaccatatggagttgaagaagggacaccattcactttctcaatagatggaggccaggttgtgggttttaagggacgaggtgattggt |
43244880 |
T |
 |
| Q |
111 |
atttggactcaattgccttcactttgtcaagtgcacccacaaaatctctgcttcagaaggtgcagagaggcttgtataggctcacaagcattgctccaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244881 |
atttggactcaattgccttcactttgtcaagtgcacccacaaaatctctgcttcagaaggtgcagagaggcttgtataggctcacaagcattgctccaaa |
43244980 |
T |
 |
| Q |
211 |
atcttcatccacttgggctgcttagaagactatatatgggaatttaagcctcttgcctcagtattgagtaatttggttcatgctatattgtttgcctttt |
310 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244981 |
atcttcttccactagggctgcttagaagactatatatgggaatttaagcctcttgcctcagtcttgagtaatttggttcatgctatattgtttgcctttt |
43245080 |
T |
 |
| Q |
311 |
ttacttttgttgcttatatttctttgaagcttatgat |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43245081 |
ttacttttgttgcttatatttctttgaagcttatgat |
43245117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 283 - 341
Target Start/End: Original strand, 39866148 - 39866206
Alignment:
| Q |
283 |
ttggttcatgctatattgtttgccttttttacttttgttgcttatatttctttgaagct |
341 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39866148 |
ttggttcatgctatgttgtttgccttttttacttttgttgcttatatttctatgaagct |
39866206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 130 - 241
Target Start/End: Original strand, 39866039 - 39866140
Alignment:
| Q |
130 |
cactttgtcaagtgcacccacaaaatctctgcttcagaaggtgcagagaggcttgtataggctcacaagcattgctccaaaatcttcatccacttgggct |
229 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||| |||||||||||||||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
39866039 |
cactttatctagtgcacccacaaagtctctgcttcataaggtgcagagaggctcgt----------aagcattgctccaaaatcttcatccaacaaggct |
39866128 |
T |
 |
| Q |
230 |
gcttagaagact |
241 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39866129 |
gcttagaagact |
39866140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University