View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5768_high_5 (Length: 568)
Name: NF5768_high_5
Description: NF5768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5768_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 8e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 77 - 189
Target Start/End: Original strand, 42590891 - 42591004
Alignment:
| Q |
77 |
taatggcaatcatattgggtagtgagcatagtggtgataacagaattgaagaagggcattc-cctatggaatagtgtggttaaagataatttctaactgt |
175 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
42590891 |
taatggcagtcatgttgggtagtgagcatagtggtgataacagaattgaagaagggccttctcctatggaatagtgtggttgaagataatttctaaccgt |
42590990 |
T |
 |
| Q |
176 |
aatacaagctggtg |
189 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42590991 |
aatacaagctggtg |
42591004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 226 - 335
Target Start/End: Original strand, 42591181 - 42591288
Alignment:
| Q |
226 |
atgtttcgtgtacatcgttttaacaccattctatagacattatgttgaaatgtcgtagcatgaattgaaacggtggcttactatttgcgttgcaatgaaa |
325 |
Q |
| |
|
||||||| |||| ||||||||||||||||| ||| ||| | ||||||||| | ||||||||||| |||| | |||||||||||| |||| ||||||| |
|
|
| T |
42591181 |
atgtttcttgtatatcgttttaacaccattacatacacagt--gttgaaatgacctagcatgaattcaaacaatagcttactatttgtgttgaaatgaaa |
42591278 |
T |
 |
| Q |
326 |
ctttttctat |
335 |
Q |
| |
|
|||||||||| |
|
|
| T |
42591279 |
ctttttctat |
42591288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University