View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5768_low_22 (Length: 277)
Name: NF5768_low_22
Description: NF5768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5768_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 23 - 262
Target Start/End: Original strand, 48635450 - 48635689
Alignment:
| Q |
23 |
tatatatattaaggtgaaagttgcacggaatggaattgaatgtagtgtatagcaagttaacgtacgtgtgggtggggaggctcgaaaactaaggcaaaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48635450 |
tatatatattaaggtgaaagttgcacggaatggaatggaatgtagtgtataggaagttaacgtacgtgtgggtggggaggctcgaaaactaaggcaaaaa |
48635549 |
T |
 |
| Q |
123 |
gagagatttgcaaattaagttggaagggagggagggggagtgaatgttgttaatttaacttaataatgcaataaaatagtgtccttggtcttacttgtat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48635550 |
aagagatttgcaaattaagttggaagggagggagggggagtgaatgttgttaatttaacttaataatgcaataaaatagtgtccttggtcttacttgtat |
48635649 |
T |
 |
| Q |
223 |
tgtcaatgaaatcaaggtggatatataatatcaaaagatt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48635650 |
tgtcaatgaaatcaaggtggatatataatatcaaaagatt |
48635689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University