View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5769_high_3 (Length: 374)
Name: NF5769_high_3
Description: NF5769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5769_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 2 - 357
Target Start/End: Complemental strand, 41144843 - 41144485
Alignment:
| Q |
2 |
taacgtggcagagtcgaatatagcgtagaaagcaatttgcgcatgagggaggtgagtctcatttcatctttctttttcattcccttttactaaacataac |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41144843 |
taacgtggcagggtcgaatatagcgtagaaagcaatttgcgcatgagg----tgagtctcatttcatctttctttttcattcccttttactaaacataac |
41144748 |
T |
 |
| Q |
102 |
agaatgatgaaatgaaatgaatatacata----gacaaaacttggtctaagatagctgggtcccgcagttgatttgatccaaatccaatcaaatccgacc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41144747 |
agaatgatgaaatgaaatgaatatacatacatagacaaaacttggtctaagctagctgggtcccgcagttgatttgatccaaatccaatcaaatccgacc |
41144648 |
T |
 |
| Q |
198 |
gacgccgttttgattgaattctatgtcggaaccaccaccatcatcatc---ctcttccactagcacggcggttagtttcagagataatttatggaaagga |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41144647 |
gacgccgttttgattgaattctatgtcggaaccaccaccatcatcatcatcctctaccactagcacggcggttagtttcagagataatttatggaaagga |
41144548 |
T |
 |
| Q |
295 |
actttcgctgtctccggtatcatgctcactctcgtcacctatggcctcttacaggtaatcttt |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41144547 |
actttcgctgtctccggtatcatgctcactctcgtcacctatggcctcttacaggtaatcttt |
41144485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 357
Target Start/End: Complemental strand, 23313893 - 23313837
Alignment:
| Q |
301 |
gctgtctccggtatcatgctcactctcgtcacctatggcctcttacaggtaatcttt |
357 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||||||| |||| ||||||| |||| |
|
|
| T |
23313893 |
gctgtctccggaatcatgctcacccttgtcacctatggcgtcttgcaggtaaccttt |
23313837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University