View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5770-Insertion-6 (Length: 120)
Name: NF5770-Insertion-6
Description: NF5770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5770-Insertion-6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 6 - 120
Target Start/End: Complemental strand, 28864649 - 28864535
Alignment:
| Q |
6 |
catttacctcatcaccatgggcatgattttgatcttctgtgttgaggacttaggagtttatcttcctcgaaggccaccatacgcaaatgtaatggatcct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28864649 |
catttacctcatcaccatgggcatgattttgatcttctgtgttgaggacttaggagtttatcttcctcgaaggccaccatacgcaaatgtaatggatcct |
28864550 |
T |
 |
| Q |
106 |
ccaccatcagcttag |
120 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
28864549 |
ccatcatcagcttag |
28864535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University