View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5770-Insertion-7 (Length: 85)
Name: NF5770-Insertion-7
Description: NF5770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5770-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 5e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 5e-25
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 3570949 - 3571010
Alignment:
| Q |
8 |
tggagcactattagttttacatttttcttacccaataaccgtagcagaacttaactttatga |
69 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570949 |
tggagtactattagttttacatttttcttacccaataaccgtagcagaacttaactttatga |
3571010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 5e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 5e-25
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 38927892 - 38927953
Alignment:
| Q |
8 |
tggagcactattagttttacatttttcttacccaataaccgtagcagaacttaactttatga |
69 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38927892 |
tggagtactattagttttacatttttcttacccaataaccgtagcagaacttaactttatga |
38927953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 7e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 7e-24
Query Start/End: Original strand, 14 - 69
Target Start/End: Original strand, 46354324 - 46354379
Alignment:
| Q |
14 |
actattagttttacatttttcttacccaataaccgtagcagaacttaactttatga |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46354324 |
actattagttttacatttttcttacccaataaccgtagcagaacttaactttatga |
46354379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University