View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5770_high_6 (Length: 289)
Name: NF5770_high_6
Description: NF5770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5770_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 85 - 271
Target Start/End: Complemental strand, 41569804 - 41569618
Alignment:
| Q |
85 |
acaatgaatggatttgatgtaaaagaatattgttgatttgtttttgtgccaggttgaacatggttggttgatttatatatgtggctgaattcagaagatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41569804 |
acaatgaatggatttgatgtaaaagaatattgttgatttgtttttgtgccaggttgaacatggttggttgatttatatatgtggctgaattcagaagatt |
41569705 |
T |
 |
| Q |
185 |
tggtgtatactaatgtatgaaccgtgtccaattcagaagattttttgtataatgattcaacactgcaaatgcacagagcaaaataac |
271 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41569704 |
tggtgtgtactaatgtatcaaccgtgtccaattcagaagattttttgtgtaatgattcaacactgcaaatgcacagagcaaaataac |
41569618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 119 - 216
Target Start/End: Complemental strand, 41556081 - 41555984
Alignment:
| Q |
119 |
gatttgtttttgtgccaggttgaacatggttggttgatttatatatgtggctgaattcagaagatttggtgtatactaatgtatgaaccgtgtccaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
41556081 |
gatttgtttttgtgccaggttgaacatggttggttgatttatatatgtggctaaattcagaagatttggtgtgtactaatgtatcaaccgtgtccaat |
41555984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 2 - 88
Target Start/End: Complemental strand, 41569928 - 41569842
Alignment:
| Q |
2 |
ccaagaatatgggaagagaattcactctctctttgttcatggtgtgaatcaacaattcttttgtccatttacaacaaattataacaa |
88 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41569928 |
ccaagaataggggaagagaattcactctcactttgttcatggtgtgaatcaacaattcttttgtccatttacaacaaattataacaa |
41569842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 41556211 - 41556155
Alignment:
| Q |
13 |
ggaagagaattcactctctctttgttcatggtgtgaatcaacaattcttttgtccat |
69 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| | |||||| |||||||||||| |
|
|
| T |
41556211 |
ggaagagaattcactctcactatgttcatggtgtggaccaacaactcttttgtccat |
41556155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 78
Target Start/End: Complemental strand, 41588862 - 41588797
Alignment:
| Q |
13 |
ggaagagaattcactctctctttgttcatggtgtgaatcaacaattcttttgtccatttacaacaa |
78 |
Q |
| |
|
||||| ||||||||||| |||||||||||| ||| |||||||| || ||||||||| || ||||| |
|
|
| T |
41588862 |
ggaagtgaattcactcttactttgttcatggagtggatcaacaactcctttgtccatctataacaa |
41588797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University