View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5772-Insertion-5 (Length: 246)
Name: NF5772-Insertion-5
Description: NF5772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5772-Insertion-5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 244
Target Start/End: Original strand, 10751820 - 10752056
Alignment:
| Q |
8 |
tcgcgagcatgtgcgaagctgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagatggattacaaatatgtctga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10751820 |
tcgcgagcatgtgcgaagctgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagatggattacaaatatgtctga |
10751919 |
T |
|
| Q |
108 |
atcaagtcttcaaacaataagctatggcgccaatcatatctatgattgcaagggtcatatttaattttctgcttctgacataaaattttgagtaatttag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10751920 |
atcaagtcttcaaacaataagctatggcaccaatcatatctatgattgcaagggtcatatttaattttctgcttctgacataaaattttgagtagtttag |
10752019 |
T |
|
| Q |
208 |
tttaacagcctgattattttgtctacacatttttcac |
244 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10752020 |
tttaacggcctgattattttgtctacacatttttcac |
10752056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 27 - 119
Target Start/End: Original strand, 32561286 - 32561378
Alignment:
| Q |
27 |
tgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagatggattacaaatatgtctgaatcaagtcttca |
119 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||| |||| |||| |||||| | ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
32561286 |
tgatgtaagatggccttcttttgcatataatataaaaggagaattgaatggtcctatgagatgggttacaaatatgtctgattcaagccttca |
32561378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University