View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5772-Insertion-6 (Length: 140)
Name: NF5772-Insertion-6
Description: NF5772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5772-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 8e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 42096604 - 42096482
Alignment:
| Q |
8 |
caaatcacataatgaaaaagtaataagacgcttggaaattacagcacacatctgcagactgcgataattcatttttaccaaatctttcacactttctcta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
42096604 |
caaatcacataatgaaaaagtaataagacgcttggaaattacagcacacatctgcagactgcgatgattaatttttaccaaatctttcacactttctcta |
42096505 |
T |
|
| Q |
108 |
tttgttgggtcctaatccaataa |
130 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42096504 |
tttgttgggtcctaatccaataa |
42096482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University