View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5772_high_14 (Length: 239)
Name: NF5772_high_14
Description: NF5772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5772_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 34642130 - 34641955
Alignment:
| Q |
18 |
gggaccaacctatatatttatgtctccaaatcttaccagaaattagcgttgttaattaaatgtaacnnnnnnnnnnagatgataccattcaatttcagtt |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34642130 |
gggaccaacctatatatttatttctccaaatcttaccagaaattagtgttgttaattaaatgta--ttttttttttagatgataccattcaatttcagtt |
34642033 |
T |
|
| Q |
118 |
tccatagaaagaaacaagacccacctaatttctagtgaatttacagataaaggttttaaattgtggttgcaatcatta |
195 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34642032 |
tccatagaaagaaacaagacccacttaatttctagtgaatttatagataaaggttttaaattgtggttgcaatcatta |
34641955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University