View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5772_low_8 (Length: 315)
Name: NF5772_low_8
Description: NF5772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5772_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 34641872 - 34641564
Alignment:
| Q |
1 |
aaaacgtaaactcacaatagaagtatatgattggaagaggatggagatcaagattatagacatgatgttgcatatataattgtatttggatttgctgccc |
100 |
Q |
| |
|
||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34641872 |
aaaacttaaactctcaatagaagtttatgattggaagaggatggagatcaagattatagacatgatgttgcatatataattgtatttggatttgctgccc |
34641773 |
T |
 |
| Q |
101 |
tttccacatcgcaaagtttttaatatcatctatctcaaataaatgttcgagatcatttaaagcttattttattattgtataatttgagttgttcgaaccc |
200 |
Q |
| |
|
|| || |||| || |||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||| || ||||||| |
|
|
| T |
34641772 |
ttgccgcatcacatagtttttaatatcacccatctcaaataaatgttcgagatcatttaaagctaattttattattgtgtaatttaagtcgtccgaaccc |
34641673 |
T |
 |
| Q |
201 |
atattaatgatcgagaatgtttaccgcatgcaaacacnnnnnnnncgagcaaataatccagatccatctgtcttctcactgcaggtgtagtcaacgatag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34641672 |
atattaatgatcgagaatgtttaccgcatgtaaacac-tttttttcgagcaaataatccagatccatctgtcttctcactgcaggtgtagtccacgatag |
34641574 |
T |
 |
| Q |
301 |
tcctttgctt |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
34641573 |
tcctttgctt |
34641564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University